View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4683-Insertion-5 (Length: 197)
Name: NF4683-Insertion-5
Description: NF4683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4683-Insertion-5 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 8 - 197
Target Start/End: Original strand, 52174909 - 52175098
Alignment:
| Q |
8 |
gttgattctgtcatgaacctatcttggaaattgtttttaggaaaaacagtgggtctaccttgtcttttctatgaaaagttttatcaccctctagattgta |
107 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52174909 |
gttgattctgtcaagaacctatcttggaaattgtttttaagaaaaacagtgggtctaccttgtcttttctatgaaaagttttatcaccctctagattgta |
52175008 |
T |
|
| Q |
108 |
tgttaagatagactcgttgatttgttggtttcagtcgaattctttaatctttattcttggggagggttgagtagtacttgtattttatct |
197 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52175009 |
tgttaagatagattcgttgatttgttggtttcagtcgaattctttaatctttattcttggggagggttgagtagtacttgtattttatct |
52175098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University