View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4683_low_4 (Length: 259)
Name: NF4683_low_4
Description: NF4683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4683_low_4 |
 | |
|
| [»] scaffold0288 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0288 (Bit Score: 175; Significance: 3e-94; HSPs: 2)
Name: scaffold0288
Description:
Target: scaffold0288; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 31 - 236
Target Start/End: Complemental strand, 15518 - 15315
Alignment:
| Q |
31 |
caataaccgaacaaaaagagaatagaggatttagagatttttgcgatgaccaagccaaaagagtatttggcatagccacagacaggaagatttgtgatgc |
130 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
15518 |
caataaccgaacaaaaagaggatagaggatttagagatttttgcgatgaccaagccaaaagagtatttggcatagccacggacaggaagatttgtgatgc |
15419 |
T |
|
| Q |
131 |
caaaccaaaagaggatttggcatagtcgcctgactttagacttgtgtagtgaccgaatcaaaaatagacttaacgcaatatcactattttaagtttgtgt |
230 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
15418 |
caaaccaaaagatgatttggcatagtcgcctgactttagacttgtgtagtgaccgaatcaaaaatagacttaactca--atcactattttaagtttgtgc |
15321 |
T |
|
| Q |
231 |
gataat |
236 |
Q |
| |
|
|||||| |
|
|
| T |
15320 |
gataat |
15315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0288; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 181 - 236
Target Start/End: Complemental strand, 15292 - 15239
Alignment:
| Q |
181 |
gaccgaatcaaaaatagacttaacgcaatatcactattttaagtttgtgtgataat |
236 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||||| |||||| |
|
|
| T |
15292 |
gaccgaatcaaaaatagacttaactca--atcactattttaagtttgtgcgataat |
15239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University