View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4683_low_8 (Length: 212)
Name: NF4683_low_8
Description: NF4683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4683_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 18 - 196
Target Start/End: Complemental strand, 47726029 - 47725851
Alignment:
| Q |
18 |
gataggtcgctataacaatgacctaaaaataaaacgtgacatttcaattgccattcattatggttactttccaacttcaatcgaatactataatagataa |
117 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
47726029 |
gataggtcgctataacaatgacccaaaaataaaacgtgaaatttcaattgccattcattatggttactttccaacttcaatccaatactataatagataa |
47725930 |
T |
|
| Q |
118 |
taattgaaatcgtttacaacaatggttgataatagaaaaatataaatcaaagagattgatcgagaaatttgacgttcat |
196 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47725929 |
taattgaaatcatttacaacaatggttgataatagaaaaatataaatcaaagagattcatcgagaaatttgacgttcat |
47725851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University