View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4684_high_12 (Length: 238)
Name: NF4684_high_12
Description: NF4684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4684_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 7417531 - 7417774
Alignment:
| Q |
1 |
tgggaagatgtgcgtaccagccatggaagcattaagaggagctggatagagtgaagaatactcaaatggattgttaacatttgttgtggtggttgttatg |
100 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7417531 |
tgggaagaattgcgtaccagccatgaaagcattaagaggagctggatatagtgaagaatactcaaatggattgttaacatttgttgttgtggttgttatg |
7417630 |
T |
 |
| Q |
101 |
agattttgttgatttcctt---------------cgccgccaccggtagaaccctcgccaccaccagcagcagcatttggactagtgtagctaccttcaa |
185 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
7417631 |
agattttgttgatttccttcgccgccacttccaccgccgccaccggtagaaccctcgccaccagcaacagcagcatttggactagtgtagctaccttcaa |
7417730 |
T |
 |
| Q |
186 |
gtccttgatcatacaaaattcccttgaaaactcttcctcctatg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7417731 |
gtccttgatcatacaaaattcccttgaaaactcttcctcctatg |
7417774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University