View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4684_high_5 (Length: 342)
Name: NF4684_high_5
Description: NF4684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4684_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 7 - 335
Target Start/End: Original strand, 44883122 - 44883450
Alignment:
| Q |
7 |
ataaacacttggattcacctcaggtacaacactttgtggtattagtggcatagttgaagctacgacatttgtgtcagataaattggattgtaaagccatg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44883122 |
ataaacacttggattcacctcaggtacaacactttgtggtattagtggcatagttgaagctacgacatttgtgtcagataaattggattgtaaagccatg |
44883221 |
T |
 |
| Q |
107 |
ttgtatggttgtgtcgatccatgtccaattggcattacataaacaggatactgatgaagttggtgtgattgtgatgttggggcataaactgggtagtagg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44883222 |
ttgtatggttgtgtcgatccatgtccaattggcattacataaacaggatactgatgaagttggtgtgattgtgatggtggggcataaactgggtagtagg |
44883321 |
T |
 |
| Q |
207 |
atgacattggaacttgacctgtacctataggacgatgaatatagacaaattgatgttgttgatatgtctgaggttgctggttttgattcaattgttgttg |
306 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44883322 |
atgacaatggaacttgacctgtacctataggacgatgaatatagacaaattgatgttgttgatatgtctgaggttgctggttttgattcaattgttgttg |
44883421 |
T |
 |
| Q |
307 |
aggtggggtgtaaccaagatcctttgctt |
335 |
Q |
| |
|
|||||||||||| ||||||||||||||| |
|
|
| T |
44883422 |
gggtggggtgtaatcaagatcctttgctt |
44883450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University