View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4684_low_11 (Length: 258)
Name: NF4684_low_11
Description: NF4684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4684_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 7 - 162
Target Start/End: Original strand, 7416999 - 7417154
Alignment:
| Q |
7 |
gagttgagcaccaactacaaacaaagttacattacatcactcactcattcatcactacacaattttaattcctcataatgctataaataaatcaaatcaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7416999 |
gagttgagcaccaactacaaacaaagttacattacatcactcactcattcatcactacacaattttaattcctcataatgctataaataaatcaaatcaa |
7417098 |
T |
 |
| Q |
107 |
atcaaagaaaaatatattgaaattgcacacatccaaatgttgtctgcgccgcgtaa |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7417099 |
atcaaagaaaaatatattgaaattgcacacatccaaatgttgtctgcgccgcgtaa |
7417154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University