View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4684_low_12 (Length: 255)
Name: NF4684_low_12
Description: NF4684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4684_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 22 - 246
Target Start/End: Original strand, 32030958 - 32031182
Alignment:
| Q |
22 |
caggtgaccttggagacttcattgtagaatatggaggtgattacagaatgataagcatattcaatgctccatttcaagttggtttttataacactacccc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32030958 |
caggtgaccttggagacttcattgtagaatatggaggtgattacagaatgataagcatattcaatgctccatttcaagttggtttttataacactacccc |
32031057 |
T |
|
| Q |
122 |
aaatgcattcactttagctcttcgaatcggtcttcaacgatcggagcagcttttccggtgggtatgggaagcaaatagaggcaatccagttggggaaaat |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32031058 |
aaatgcattcactttagctcttcgaatcggtcttcaacgatcggagcagcttttccggtgggtatgggaagcaaatagaggcaatccagttggtgaaaat |
32031157 |
T |
|
| Q |
222 |
ggtactttttcattaggtgatgatg |
246 |
Q |
| |
|
||||||||||||||||||| ||||| |
|
|
| T |
32031158 |
ggtactttttcattaggtgctgatg |
32031182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 22 - 246
Target Start/End: Original strand, 32064093 - 32064317
Alignment:
| Q |
22 |
caggtgaccttggagacttcattgtagaatatggaggtgattacagaatgataagcatattcaatgctccatttcaagttggtttttataacactacccc |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| || |||||||| || |
|
|
| T |
32064093 |
caggtgaccttggagacttcattgtagaatatggaggtgattacagaatgataagcatattcaatgctccattccaagttggtttctacaacactactcc |
32064192 |
T |
|
| Q |
122 |
aaatgcattcactttagctcttcgaatcggtcttcaacgatcggagcagcttttccggtgggtatgggaagcaaatagaggcaatccagttggggaaaat |
221 |
Q |
| |
|
|||||| |||||| |||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
32064193 |
aaatgccttcactctagcacttcgaatcggacttcaacgatcggagcagcttttccggtgggtatgggaagcaaatagaggcaacccagttggtgaaaat |
32064292 |
T |
|
| Q |
222 |
ggtactttttcattaggtgatgatg |
246 |
Q |
| |
|
||||||||||||||||||| ||||| |
|
|
| T |
32064293 |
ggtactttttcattaggtgctgatg |
32064317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 47 - 237
Target Start/End: Original strand, 32077974 - 32078164
Alignment:
| Q |
47 |
agaatatggaggtgattacagaatgataagcatattcaatgctccatttcaagttggtttttataacactaccccaaatgcattcactttagctcttcga |
146 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||| |||| |||||| |
|
|
| T |
32077974 |
agaatatggaggaaattacagaatgataaacatattcaatgctccattccaagttggtttttacaacactaccccaaatgccttcactctagcacttcga |
32078073 |
T |
|
| Q |
147 |
atcggtcttcaacgatcggagcagcttttccggtgggtatgggaagcaaatagaggcaatccagttggggaaaatggtactttttcattag |
237 |
Q |
| |
|
|| || |||||||||||||||||||||||| ||||||| ||||||||||||||||||| ||||||| ||||||| ||||||||||||| |
|
|
| T |
32078074 |
atgggacttcaacgatcggagcagcttttctggtgggtgtgggaagcaaatagaggcagcccagttgatgaaaatgcaactttttcattag |
32078164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 177 - 246
Target Start/End: Original strand, 32071581 - 32071650
Alignment:
| Q |
177 |
cggtgggtatgggaagcaaatagaggcaatccagttggggaaaatggtactttttcattaggtgatgatg |
246 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||| ||||||| |||||||||||||||| ||||| |
|
|
| T |
32071581 |
cggtgggtttgggaagcaaatagaggcaacccagttgatgaaaatgcaactttttcattaggtgttgatg |
32071650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University