View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4684_low_13 (Length: 250)
Name: NF4684_low_13
Description: NF4684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4684_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 1 - 86
Target Start/End: Original strand, 44039610 - 44039695
Alignment:
| Q |
1 |
ataaatattttgcatgccgcatcataaaaaatcagtcccaaatgtagagtggagaaaatgtccagaccttttgtaaactggaagac |
86 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44039610 |
ataaatattttgcttgccgcatcataaaaaatcagtcccaaatgtagagtggagaaaatgtccagaccttttgtaaactggaagac |
44039695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 189 - 241
Target Start/End: Original strand, 44039788 - 44039840
Alignment:
| Q |
189 |
taattgaagattacctcattctgcacatacaaccaaattccctgacctttgct |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44039788 |
taattgaagattacctcattctgcacatacaaccaaattccctgacctttgct |
44039840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University