View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4684_low_3 (Length: 440)
Name: NF4684_low_3
Description: NF4684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4684_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 18 - 372
Target Start/End: Complemental strand, 48286605 - 48286251
Alignment:
| Q |
18 |
cattgttaccgtgtttgcgtcgagataagcaccgtcggattttgtggttatgttgaaacttggaacacggaaggaaccgaggtggaattctggtatggaa |
117 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
48286605 |
cattgttatcgtgtttgcgtcgagataagcaccgtcggattttgtggttatgttgaaacttggaacacggaaagaaccgaggtggaattctggtatggaa |
48286506 |
T |
|
| Q |
118 |
ggttgatagagaatgtagataactgcggcggcgaggatgaaaaggaagaagagaatgaggaagatgatgcaaaatgtgcaacaacataggcgacaataat |
217 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
48286505 |
ggttggtagagaatgtagataactgcggcggcgaggatgaaaaggaagaagagaatgaggaagatgatgcaaaatgtgcaacaaaataggcgacaataat |
48286406 |
T |
|
| Q |
218 |
tacgtttcttgggttttggtcggaaagaaggtgggagagaagggtttcgtgttggaagcggtttttgttggatgtttgggtctctataacaaggtggttt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48286405 |
tacgtttcttgggttttggtcggaaagaaggtgggagagaagggtttcgtgttggaagcggtttttgttggatgtttgggtctctataacaaggtggttt |
48286306 |
T |
|
| Q |
318 |
tggtagtattattggtttttgttcgggcgatggttgctgcattgtgattttgtgt |
372 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48286305 |
tggtagtattattggtttttgttcgggcgatggttgctgcattgtgattttgtgt |
48286251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University