View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4685-Insertion-10 (Length: 221)
Name: NF4685-Insertion-10
Description: NF4685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4685-Insertion-10 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 11 - 221
Target Start/End: Original strand, 43380339 - 43380550
Alignment:
| Q |
11 |
aatttaatgggttctaattccttgattcccatttgatcttatattgttatcttagttttgtcctcgtatgtcctggaaaggacaagcaagcaaactgtgt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43380339 |
aatttaatgggttctaattccttgattcccatttgatcttatattgttatcttagttttgtcctcgtatgtcctggaaaggacaagcaagcaaactgtgt |
43380438 |
T |
 |
| Q |
111 |
tcttaaagtttggctttccgtactccatgtctcagatcaacctttttatcc-nnnnnnnnnnnttctccgatcaacctttatgtaatgaaaagccacatt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43380439 |
tcttaaagtttggctttccgtactccatgtctcagatcaacctttttatccaaaaaaaaaaatttctccgatcaacctttatgtaatgaaaagccacatt |
43380538 |
T |
 |
| Q |
210 |
ttctctatgtaa |
221 |
Q |
| |
|
|||||||||||| |
|
|
| T |
43380539 |
ttctctatgtaa |
43380550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University