View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4685_high_16 (Length: 247)
Name: NF4685_high_16
Description: NF4685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4685_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 1367640 - 1367402
Alignment:
| Q |
1 |
cttctttctattgtcctcccgattccgcttttctctgccggagttgcgacgacgccgttcacggcgctaacttcctcgtcgctcgtcacctccgtcacat |
100 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1367640 |
cttcgttctattgtccttccgattccgcttttctctgccggagttgcgacgtcgccgttcacggcgctaacttcctcgtcgctcgtcacctccgtcacat |
1367541 |
T |
 |
| Q |
101 |
cttgtgctccaaatgcgatggtttcaccgaaattcacatctccggcactacactccaccaccgtctttcatcaacctgccgttcttgctcgccggaaaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1367540 |
cttgtgctccaaatgcgatggtttcaccgaaattctcatctccggcactgcacttcaccaccgtctttcatcaacctgccgttcttgctcgccggaaaat |
1367441 |
T |
 |
| Q |
201 |
cattcctccggtgagccgagttctcaatcttcttcatct |
239 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
1367440 |
caatcctccggtgagccgagttctcaatcttcttcatct |
1367402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University