View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4685_high_20 (Length: 235)
Name: NF4685_high_20
Description: NF4685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4685_high_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 131 - 217
Target Start/End: Complemental strand, 42214090 - 42214004
Alignment:
| Q |
131 |
ttatagaggaagagaagaagctatgaacaaatgaacataatgtaacaggttatgttcaaaaataaggacataatcatgtctatgatt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42214090 |
ttatagaggaagagaagaagctatgaacaaatgaacataatgtaacaggttatgttcaaaaataaggacataatcatgtctatgatt |
42214004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 71 - 116
Target Start/End: Complemental strand, 42214165 - 42214120
Alignment:
| Q |
71 |
tgacagattatttaagtttgtagacattgtttatgataagaggaag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42214165 |
tgacagattatttaagtttgtagacattgtttatgataagaggaag |
42214120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University