View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4685_high_21 (Length: 235)
Name: NF4685_high_21
Description: NF4685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4685_high_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 38 - 223
Target Start/End: Original strand, 1367830 - 1368016
Alignment:
| Q |
38 |
atttatgtgactgatccaatcgaattgatgtcacataaactaaccataccttattttctactc-atgttttaaatttgtggctgtcaagtgtggtacttg |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
1367830 |
atttatgtgactgatccaatcgaattgatgtcacataaactaaccataccttattttctactccatgttttaaatttgtggctgtcaagtgtggtacttg |
1367929 |
T |
|
| Q |
137 |
tatggtaactgagctacacaattaaattatttaatttataccacacaacaacttggttttatggtaatattttatttgttatatgtg |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1367930 |
tatggtaactgagctacacaattaaattatttaatttataccacacaacaacttggttttatgctaatattttatttgttatatgtg |
1368016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University