View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4685_high_22 (Length: 229)
Name: NF4685_high_22
Description: NF4685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4685_high_22 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 75 - 229
Target Start/End: Original strand, 5510936 - 5511089
Alignment:
| Q |
75 |
tacttattaggaatatttgaattgtgctatgcttctaaatgaggtatacatcaggagtatttagcaatattttgaccatcaggaatacattaaatgaggt |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5510936 |
tacttattaggaatatttgaattgtgctatgcttctaaatgaggtatacatcaggagtatttagcaatattttgaccatcaggaatacattaaatgaggt |
5511035 |
T |
|
| Q |
175 |
atacatcaggaatatttggatacttatttaggagtatttagaatattttgaccat |
229 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5511036 |
atacatcaggaatatttggatactta-ttaggagtatttagaatattttgaccat |
5511089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 7 - 48
Target Start/End: Original strand, 5510911 - 5510952
Alignment:
| Q |
7 |
tattcgacaaagttttataacaagatacttattaggaatatt |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5510911 |
tattcgacaaagttttataacaagatacttattaggaatatt |
5510952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University