View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4685_low_19 (Length: 242)
Name: NF4685_low_19
Description: NF4685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4685_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 24496456 - 24496230
Alignment:
| Q |
1 |
attatctctctacaataggttatgcagatggttgcagaataagatatgatatgcagttgaaaagaaaaagctaaaatcttcatttctaaagtagattgta |
100 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24496456 |
attatctctctatattaggttatgcagatggttgcagaataagatatgatatgcagtagaaaagaaaaagctaaaatcttcatttctaaagtagattgta |
24496357 |
T |
 |
| Q |
101 |
ttggaactcgcaggtactactttattatatgggtatctcaaagaatgattttctccttcaatgtctttaccacataacctttcctgtgcaatatacgctt |
200 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
24496356 |
ttggcacttgcaggtactactttattatatgggtatctc--agaatgattttctccttcaatatctttaccacgtaacctttcctgtgcaatataggctt |
24496259 |
T |
 |
| Q |
201 |
cattcccacattgcaaaatttgtagattg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
24496258 |
cattcccacattgcaaaatttgtagattg |
24496230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University