View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4685_low_24 (Length: 229)
Name: NF4685_low_24
Description: NF4685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4685_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 17 - 215
Target Start/End: Complemental strand, 29788185 - 29787987
Alignment:
| Q |
17 |
aagaagaaggataggttgattaagaaaccagaaaactatgatcaagcagctgtatgggagaacaggaattatggatactctccggaatctactcgaatag |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29788185 |
aagaagaaggataggttgattaagaaaccagaaaattatgatcaagcagctgtatgggagaacaggaattatggatactctccggaatctactcgaatag |
29788086 |
T |
 |
| Q |
117 |
tggtattgaagcctagtcctgggagaacaaatgaacttaaggctttggtttctccaacaaatccatcgcctcaaagtttctatcaaggaaatggagatg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29788085 |
tggtattgaagcctagtcctgggagaacaaatgatcttaaggctttggtttctccaacaaatccatcgcctcaaagtttctatcagggaaatggagatg |
29787987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University