View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4685_low_27 (Length: 225)
Name: NF4685_low_27
Description: NF4685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4685_low_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 17 - 215
Target Start/End: Complemental strand, 40402277 - 40402079
Alignment:
| Q |
17 |
atgaataatgaaaatgaaactgcaatatcaaacaatggaagtaaaatggaaggttggttatacctaattcgttgtaaccgttttggacttcaattttcta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40402277 |
atgaataatgaaaatgaaactgcaatatcaaacaatggaagtaaaatggaaggttggttatacctaattcgttgtaaccgttttggacttcaattttcta |
40402178 |
T |
|
| Q |
117 |
gaaaacgttactttgttcttcatgatcatcttcttcgtagtttcaaatccgtccccgattctaccgatcaggtttatcattttttcaatttcatctcac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40402177 |
gaaaacgttactttgttcttcatgatcatcttcttcgtagtttcaaatccattcccaattctaccgatcaggtttatcattttttcaatttcatttcac |
40402079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University