View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4686_high_3 (Length: 561)
Name: NF4686_high_3
Description: NF4686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4686_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 44424183 - 44424413
Alignment:
| Q |
1 |
atattcactcttagtgtatttcaggtgaaatctcggacaatggaagttgctaagttgattgagagtgaagatggcgttgctgcagcagttgacgcgtttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44424183 |
atattcactcttagtgtatttcaggtgaaatctcggacaatggaagttgctaagttgattgagagtgaagatggcgttgctgcagcagttgacgcgtttc |
44424282 |
T |
 |
| Q |
101 |
atcgccacctgcccgatgagctaccgctgccaactccatctcatgtggaagacgaggaccacttaagtcctcttaattggttttttgaccaacttgcaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44424283 |
atcgccacctgcccgatgagctaccgctgccaactccatctcatgtggaagacgaggaccacttaagtcctcttaattggttttttgaccaacttgcaaa |
44424382 |
T |
 |
| Q |
201 |
gtggtgttgtttgccttgtggtggtgtgtag |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
44424383 |
gtggtgttgtttgccttgtggtggtgtgtag |
44424413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 130; E-Value: 4e-67
Query Start/End: Original strand, 415 - 552
Target Start/End: Original strand, 44424553 - 44424690
Alignment:
| Q |
415 |
tagatattagatttcacccctccccctcaaacattttgcataggaggttatgtcatttgttgtagattaagagttgagagttctacttacataaagaact |
514 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44424553 |
tagatattagatttcacccctccccctcaaacattttgtataggaggttatgtcaattgttgtagattaagagttgagagttctacttacataaagaact |
44424652 |
T |
 |
| Q |
515 |
ctgctaggtgtttttgtttgatagttgatgatgatgtc |
552 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44424653 |
ctgctaggtgtttttgtttgatagttgatgatgatgtc |
44424690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 296 - 357
Target Start/End: Original strand, 44424478 - 44424539
Alignment:
| Q |
296 |
gataggaactttctgttattacagaatggtagcataatgttttggtttggtatttcattcat |
357 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44424478 |
gatagaaactttctgttattacagaatggtagcataatgttttggtttggtatttcattcat |
44424539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University