View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4686_high_4 (Length: 528)
Name: NF4686_high_4
Description: NF4686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4686_high_4 |
 |  |
|
| [»] scaffold0013 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 96; Significance: 8e-47; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 338 - 505
Target Start/End: Complemental strand, 26808843 - 26808676
Alignment:
| Q |
338 |
gagaatactccttccttgcacaattaaataactcaaaggacctccatgtttctttccccccgcacaatgggattctcaattgtgcttgttcctcatgata |
437 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |||||||| ||| |||||||| ||||| || |
|
|
| T |
26808843 |
gagaatacttcttccttgcacaattaaataactcaaaggacctccatgtttcttcccccctgcacaagtcgattctcatttgcgcttgttcgtcatgtta |
26808744 |
T |
 |
| Q |
438 |
cttaaaatttgaactactctctaacaatttaagctcaacatggatcctttcattaattaaaagttctt |
505 |
Q |
| |
|
|| |||||||| ||||||| |||||||||||||||||||||||||| |||||| |||||| ||||| |
|
|
| T |
26808743 |
gttgaaatttgagctactctttaacaatttaagctcaacatggatccattcattttttaaaaattctt |
26808676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 273 - 342
Target Start/End: Complemental strand, 26809069 - 26809000
Alignment:
| Q |
273 |
atggaaaatgggatagttcatcaaagtacatgtgttaactcacctcaacaaaatagagttgcagagagaa |
342 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| |||| | || |||||||||||| |
|
|
| T |
26809069 |
atggaaaatgggatagttcatcaaagtacatctgttaactcacctcatcaaagtggaattgcagagagaa |
26809000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 275 - 326
Target Start/End: Complemental strand, 26719517 - 26719466
Alignment:
| Q |
275 |
ggaaaatgggatagttcatcaaagtacatgtgttaactcacctcaacaaaat |
326 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
26719517 |
ggaacatgggatagtttatcaaagtacatgtgttaactctcctcaacaaaat |
26719466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 112 - 192
Target Start/End: Complemental strand, 26848415 - 26848336
Alignment:
| Q |
112 |
tgtgcatttaa-attagtagcgaaacattcttctaattttccattagccgtgtggaccagtgacataattattgtacaacct |
192 |
Q |
| |
|
||||||||||| |||||| |||||| | ||||| ||||||| ||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
26848415 |
tgtgcatttaacattagtcacgaaacctccttctcattttcctctagccgtgtggaccagt--cataattattgtaccacct |
26848336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 132 - 190
Target Start/End: Original strand, 27667818 - 27667876
Alignment:
| Q |
132 |
gaaacattcttctaattttccattagccgtgtggaccagtgacataattattgtacaac |
190 |
Q |
| |
|
||||||| ||||| ||||||| |||||||||||||||| | ||| ||||||||| |||| |
|
|
| T |
27667818 |
gaaacatccttctcattttcctttagccgtgtggaccattcacacaattattgttcaac |
27667876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 50; Significance: 2e-19; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 273 - 326
Target Start/End: Complemental strand, 52684354 - 52684301
Alignment:
| Q |
273 |
atggaaaatgggatagttcatcaaagtacatgtgttaactcacctcaacaaaat |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
52684354 |
atggaaaatgggatagttcatcaaagtacatgtgttaactcaccccaacaaaat |
52684301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 278 - 340
Target Start/End: Complemental strand, 52978499 - 52978437
Alignment:
| Q |
278 |
aaatgggatagttcatcaaagtacatgtgttaactcacctcaacaaaatagagttgcagagag |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| ||||| || ||||| |||| |
|
|
| T |
52978499 |
aaatgggatagttcatcaaagtacatgtgttaactcaccccaataaaatggaattgcatagag |
52978437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 276 - 342
Target Start/End: Complemental strand, 2703592 - 2703526
Alignment:
| Q |
276 |
gaaaatgggatagttcatcaaagtacatgtgttaactcacctcaacaaaatagagttgcagagagaa |
342 |
Q |
| |
|
|||||||| || || ||||||||| |||||||||||||||| ||||||||| || |||||||||||| |
|
|
| T |
2703592 |
gaaaatggaattgtacatcaaagttcatgtgttaactcaccccaacaaaatggaattgcagagagaa |
2703526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 46; Significance: 5e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 273 - 326
Target Start/End: Complemental strand, 36089760 - 36089707
Alignment:
| Q |
273 |
atggaaaatgggatagttcatcaaagtacatgtgttaactcacctcaacaaaat |
326 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36089760 |
atggaaaatgagatagttcatcaaagtacatgtgttaactcaccccaacaaaat |
36089707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 46; Significance: 5e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 273 - 326
Target Start/End: Original strand, 33718093 - 33718146
Alignment:
| Q |
273 |
atggaaaatgggatagttcatcaaagtacatgtgttaactcacctcaacaaaat |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
33718093 |
atggaaaatgggatagttcatcaaagtacatgtgttaacttaccccaacaaaat |
33718146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 273 - 326
Target Start/End: Original strand, 18931397 - 18931450
Alignment:
| Q |
273 |
atggaaaatgggatagttcatcaaagtacatgtgttaactcacctcaacaaaat |
326 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |||||| ||||||||| |
|
|
| T |
18931397 |
atggaaaatgggatagttcagcaaagtacatgtgttagctcaccccaacaaaat |
18931450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 114 - 215
Target Start/End: Original strand, 17994141 - 17994244
Alignment:
| Q |
114 |
tgcatttaa-attagtagcgaaacattcttctaattttccattagccgtgtggaccagtgacataattattgtacaacctca-ttttcctcccactgtca |
211 |
Q |
| |
|
||||||||| || ||| ||||||| | ||||| ||| ||| ||||||||||||||||| ||| |||||||| || |||||| |||||||||||| |||| |
|
|
| T |
17994141 |
tgcatttaacatcagtggcgaaacttccttctcattctcctatagccgtgtggaccagtcacacaattattgcactacctcatttttcctcccacagtca |
17994240 |
T |
 |
| Q |
212 |
cttt |
215 |
Q |
| |
|
|||| |
|
|
| T |
17994241 |
cttt |
17994244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0013 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0013
Description:
Target: scaffold0013; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 291 - 342
Target Start/End: Original strand, 13605 - 13656
Alignment:
| Q |
291 |
catcaaagtacatgtgttaactcacctcaacaaaatagagttgcagagagaa |
342 |
Q |
| |
|
||||||||| |||||||||||||||| ||| ||||| || |||||||||||| |
|
|
| T |
13605 |
catcaaagttcatgtgttaactcaccccaaaaaaatggaattgcagagagaa |
13656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University