View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4687_high_6 (Length: 209)
Name: NF4687_high_6
Description: NF4687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4687_high_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 7e-85; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 19 - 198
Target Start/End: Original strand, 11606161 - 11606340
Alignment:
| Q |
19 |
tgaacatcttcacggacccctttttgtagaattacttcttcttgaagtaaccaactcagtttgtccaataaaaatgatactgaactatctgccattttct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11606161 |
tgaacatcttcacggacccctttttgtagaattacttcttcttgaagtaaccaactcagtttgtccaataaaaatgatactgaactatctgccattttct |
11606260 |
T |
|
| Q |
119 |
tctctcaactttttactgtcttgccttaaatttctaactctctcttcnnnnnnngtgcgctctcaagaaccttgatgatg |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
11606261 |
tctctcaactttttactgtcttgccttaaatttctaactctctcttctttttttgtgcgctctcaagaaccttgatgatg |
11606340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 19 - 116
Target Start/End: Complemental strand, 11639903 - 11639806
Alignment:
| Q |
19 |
tgaacatcttcacggacccctttttgtagaattacttcttcttgaagtaaccaactcagtttgtccaataaaaatgatactgaactatctgccatttt |
116 |
Q |
| |
|
||||||||||||||||| ||| |||||||| ||||||| |||||||||||||| | || |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
11639903 |
tgaacatcttcacggactcctctttgtagatttacttcctcttgaagtaaccatgttagcttgtccaataaaaatgatactgaactgtctgccatttt |
11639806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 19 - 114
Target Start/End: Complemental strand, 11621412 - 11621317
Alignment:
| Q |
19 |
tgaacatcttcacggacccctttttgtagaattacttcttcttgaagtaaccaactcagtttgtccaataaaaatgatactgaactatctgccatt |
114 |
Q |
| |
|
||||||||||||||||| ||| |||||||| |||| |||||||||||||||||| | || || ||||| ||||||||||||||||| ||||||||| |
|
|
| T |
11621412 |
tgaacatcttcacggacgcctctttgtagatttacctcttcttgaagtaaccaagttagcttctccaacaaaaatgatactgaactctctgccatt |
11621317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University