View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4688_high_2 (Length: 251)
Name: NF4688_high_2
Description: NF4688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4688_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 35279001 - 35278759
Alignment:
| Q |
1 |
ttggttattaacattctgcagaaatcttcaagtcattatatgtcctttcgcgtgtatgtatgttgtctta-ggaagtggatattgatgcatttagctagt |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
35279001 |
ttggttattaacattctgcagaaatcttcaagtcattatatgtcctttcgcgtgtatgtatgttgtcttaaggaagtggatattgatgcatttagctagt |
35278902 |
T |
 |
| Q |
100 |
gatcatgtagaagtggttggtggcgcatcctttacttaagtttctgcataattgacaacttcttcaagagctttgtttagtttgttatcttctttgaatt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35278901 |
gatcatgtagaagtggttggtggcgcatcctttacttaagtttctgcataattgacaacttcttcaagagctttgtttagtttgttatcttctttgaatt |
35278802 |
T |
 |
| Q |
200 |
gacacaattgacgtttgttgtcaatgttgtttgttcttcttct |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35278801 |
gacacaattgacgtttgttgtcaatgttgtttgttcttcttct |
35278759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University