View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4689-Insertion-13 (Length: 232)
Name: NF4689-Insertion-13
Description: NF4689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4689-Insertion-13 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 8 - 232
Target Start/End: Original strand, 56312410 - 56312634
Alignment:
| Q |
8 |
agaaggagtggtacttttatgtgcctcgagataggaagtatcgaaacggtgatcgtccaaatcgtgtaacaacttctggttattggaaggcaacaggagc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56312410 |
agaaggagtggtacttttatgtgcctcgagataggaagtatcgaaacggtgatcgtccaaatcgtgtaacaacttctggttattggaaggcaacaggagc |
56312509 |
T |
 |
| Q |
108 |
agataggatgattcgaactgaaaacttccgttcaattggactcaagaaaaccctagttttctattctggaaaagctcctaaaggcatccgaaccagttgg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56312510 |
ggataggatgattcgaactgaaaacttccgttcaattggactcaagaaaaccctagttttctattctggaaaagctcctaaaggcatccgaaccagttgg |
56312609 |
T |
 |
| Q |
208 |
attatgactgagtatagattacccc |
232 |
Q |
| |
|
||||||| ||||||||||||||||| |
|
|
| T |
56312610 |
attatgaatgagtatagattacccc |
56312634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University