View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4689-Insertion-15 (Length: 344)
Name: NF4689-Insertion-15
Description: NF4689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4689-Insertion-15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 58 - 340
Target Start/End: Original strand, 41367088 - 41367370
Alignment:
| Q |
58 |
ttaaggaataagagaaatttgatgaggatattaatcctgagggacatggttaaggtagaagagttggtggatatgaaaggggtaaatttttgccccaatc |
157 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41367088 |
ttaaggaataagagtaatttgatgaggatattaatcctgagggacatggttaaggtagaagagttggtggatatgaaaggggtaaatttttgcaccaatc |
41367187 |
T |
|
| Q |
158 |
ctatcttggtaatttttgcaataattattgtgttcttagggaccttggctacattcgtagtagatacactttgactaataaacagattttgtgcaaattc |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41367188 |
ctatcttggtaatttttgcaataattattgtgttcttagggaccttggctacattcgtagtagatacactttgactaataaacagattttgtgcaaattc |
41367287 |
T |
|
| Q |
258 |
taggtggataaatttatttcctagatttagtaatcattatttaagtctctatacttctgatcataattcaattctgctagaat |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41367288 |
taggtggataaatttatttcctagatttagtaatcattatttaactctctatacttctgatcataattcaattctgctagaat |
41367370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University