View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4689-Insertion-22 (Length: 121)
Name: NF4689-Insertion-22
Description: NF4689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4689-Insertion-22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 105; Significance: 7e-53; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 105; E-Value: 7e-53
Query Start/End: Original strand, 8 - 116
Target Start/End: Original strand, 11399372 - 11399480
Alignment:
| Q |
8 |
ggaacatacaatgacaattatatacgaactcacccatttggcttcaactccaaacaggctaacggctgataactccactctgaatttaaatccttttact |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11399372 |
ggaacatacaatgacaattatatacgaactcacccatttggcttcaactccaaacagactaacggctgataactccactctgaatttaaatccttttact |
11399471 |
T |
 |
| Q |
108 |
ttcgccttt |
116 |
Q |
| |
|
||||||||| |
|
|
| T |
11399472 |
ttcgccttt |
11399480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University