View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4689_high_32 (Length: 250)
Name: NF4689_high_32
Description: NF4689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4689_high_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 23445691 - 23445927
Alignment:
| Q |
1 |
tttctgctgaataatggcaaatttgttaagtttagttagattttattacaatttgttaagtctgttgtcaataagtttgtcgctctcttgtaatatgtgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23445691 |
tttctgctgaataatggcaaatttgttaagtttagttagattttattacagtttgttaagtctgttgtcaataagtttgtcgctctcttgtaatatgtgg |
23445790 |
T |
|
| Q |
101 |
tcctatatgtgctagtaagctattgtgataaaattagatttgtcatgttcatggtagtatctgaaatctttgttgcacaactttgaattaataaaatgtc |
200 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
23445791 |
tcctatatgtgctagtaagctattgtaataaaattagatttgtcatgttcatggtagtatctgaaatctttgttgcacaactttgaattcataaaatgtc |
23445890 |
T |
|
| Q |
201 |
tttattgttgaagctactttacttcgattgctttttc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23445891 |
tttattgttgaagctactttacttcgattgctttttc |
23445927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 160 - 244
Target Start/End: Original strand, 23446881 - 23446964
Alignment:
| Q |
160 |
tctgaaatctttgttgcacaactttgaattaataaaatgtctttattgttgaagctactttacttcgattgctttttcatctctc |
244 |
Q |
| |
|
|||| |||||||||||||||| |||||||| ||||| |||||||||||||||| ||||| ||||||||||||||| |||| |||| |
|
|
| T |
23446881 |
tctgtaatctttgttgcacaaatttgaattcataaattgtctttattgttgaa-ctactctacttcgattgctttctcatatctc |
23446964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 22 - 131
Target Start/End: Complemental strand, 24298805 - 24298697
Alignment:
| Q |
22 |
tttgttaagtttagttagattttattacaatttgttaagtctgttgtcaataagtttgtcgctctcttgtaatatgtggtcctatatgtgctagtaagct |
121 |
Q |
| |
|
|||||| |||| ||||||||| | || ||||||||| | | |||| ||||| |||| ||| |||||||||| |||||||||| ||||||||||| |||| |
|
|
| T |
24298805 |
tttgttgagttcagttagattatgtt-caatttgttgactttgttatcaattagttagtccttctcttgtaacatgtggtcctttatgtgctagtgagct |
24298707 |
T |
|
| Q |
122 |
attgtgataa |
131 |
Q |
| |
|
|||||||||| |
|
|
| T |
24298706 |
attgtgataa |
24298697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University