View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4689_high_40 (Length: 240)
Name: NF4689_high_40
Description: NF4689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4689_high_40 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 6e-55; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 14 - 126
Target Start/End: Original strand, 12735233 - 12735345
Alignment:
| Q |
14 |
agagcatataaggttgtctgcattggaaatgaaaggactctggtttgatgaatcgttcatcatccactgccaaaattagagatgttatgacttataagct |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12735233 |
agagcatataaggttgtctgcattggaaatgaaaggactctggtttgatgcatcgttcatcatccactgccaaaattagagatgttatgacttataagct |
12735332 |
T |
|
| Q |
114 |
aacaattaattgg |
126 |
Q |
| |
|
||||||||||||| |
|
|
| T |
12735333 |
aacaattaattgg |
12735345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 14 - 90
Target Start/End: Original strand, 12763949 - 12764025
Alignment:
| Q |
14 |
agagcatataaggttgtctgcattggaaatgaaaggactctggtttgatgaatcgttcatcatccactgccaaaatt |
90 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||| | |||||||||||| |||||||| |||||||||||||| |
|
|
| T |
12763949 |
agagcatatgaggttgtctgcattgggaatgaaaggattttggtttgatgaaatgttcatcacccactgccaaaatt |
12764025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 182 - 240
Target Start/End: Original strand, 12735401 - 12735459
Alignment:
| Q |
182 |
gtttttgttcaataagagtttgcatgaactgtctagaaagcctagctcaactgacaaat |
240 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
12735401 |
gttttcgttcaataagagtttacatgaactgtctagaagtactagctcaactgacaaat |
12735459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University