View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4689_high_50 (Length: 221)
Name: NF4689_high_50
Description: NF4689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4689_high_50 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 10 - 202
Target Start/End: Complemental strand, 24121206 - 24121014
Alignment:
| Q |
10 |
tgagatgaatggagagagatgtttaacgtcacaggaactcaaaaacaaactaactaagcctcgtatttttgccaattttgaactcaagaagcaaatacta |
109 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
24121206 |
tgagttgaatgcagagagatgtttaacgtcacaggaactcaaaaacaaactaactaagcctcgtatttttgccaattttgaactcaagaaccagatacta |
24121107 |
T |
 |
| Q |
110 |
ccaattggaacgtgtccgttaacttgcacgtttgatagtggtgaacccgcgaaacttgttgatcctaaatcctctctttctggaggatatatc |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24121106 |
ccaattggaacgtgtccgttaacttgcacgtttgatagtggtgaacccgcgaaacttgttgatcctaaatcctctctttctggaggatatatc |
24121014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University