View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4689_low_26 (Length: 251)
Name: NF4689_low_26
Description: NF4689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4689_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 2579375 - 2579616
Alignment:
| Q |
1 |
agtgacacaattcctttgtataatccactggttgtccaattcattatgagatgtggactgattaaaattcgactannnnnnnng-tggttcgaccatgtg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| |||||||||| | | ||| ||||||||| |
|
|
| T |
2579375 |
agtgacacaattcctttgtataatccactggttgtccaattcattatgaaatgtggagtgattagaattcgactattttttttggtagtttgaccatgtg |
2579474 |
T |
 |
| Q |
100 |
cgttgtttacagactattgtgtaannnnnnnctctactgttttttcgactagttttatagtctaattgcgctgtaattgatagctttttagtctcttccg |
199 |
Q |
| |
|
||||||||||| ||| |||||||| |||| ||||||||||| |||||||||||||||| |||| |||||||||| || ||||||||||||||| |
|
|
| T |
2579475 |
cgttgtttacaaactgttgtgtaattttttt-tctattgttttttcgattagttttatagtctaactgcggtgtaattgatggccttttagtctcttccg |
2579573 |
T |
 |
| Q |
200 |
atacttcttgtgctctagagacagctttggtttttagtataat |
242 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
2579574 |
atacttcttgtgctctagagacagctttagtttttagcataat |
2579616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University