View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4689_low_30 (Length: 250)
Name: NF4689_low_30
Description: NF4689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4689_low_30 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 12 - 170
Target Start/End: Original strand, 2011722 - 2011880
Alignment:
| Q |
12 |
atgaatacttatggtgttgtctccaatctaacatgagatgttgactatgtgctcacaattatttattaccattttttataagaatgtctacatgttatgt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2011722 |
atgaatacttatggtgttgtctccaatctaacatgagatgttgactatgtgctcacaattatttattaccattttttaaaagaatgtctacatgttatgt |
2011821 |
T |
 |
| Q |
112 |
tataaatggataatagcatcaatgctcatagtactgtagtcaagtttcatcttgaactt |
170 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||| ||||||||| |||||||| |
|
|
| T |
2011822 |
tataaatggataatagcagcaatggtcatagtactgtagttaagtttcatgttgaactt |
2011880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University