View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4689_low_35 (Length: 246)
Name: NF4689_low_35
Description: NF4689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4689_low_35 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 18 - 135
Target Start/End: Original strand, 1803668 - 1803785
Alignment:
| Q |
18 |
gcacaatcaacaacaattatccgtttctcaagtggcatattgtcgaaaattggtcacatcaacgtgtctttgatgagtcaatgtgtcttaaagcctatta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1803668 |
gcacaatcaacaacaattatccgtttctcaagtggcatattgtcgaaaattggtcacatcaacgtgtctttgatgagtcaatgtgtcttaaagcctatta |
1803767 |
T |
|
| Q |
118 |
caaatacatattttagtg |
135 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
1803768 |
caaatacatattttagtg |
1803785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 157 - 221
Target Start/End: Original strand, 1803809 - 1803873
Alignment:
| Q |
157 |
atggactaaattgacctatgagaaacataattgatgactaagggtcttgttaactaagtgattaa |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1803809 |
atggactaaattgacctatgagaaacataattgatgactaagggtcttgttaactaagtgattaa |
1803873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University