View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4689_low_37 (Length: 244)
Name: NF4689_low_37
Description: NF4689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4689_low_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 68 - 228
Target Start/End: Original strand, 33163881 - 33164041
Alignment:
| Q |
68 |
cattgcacttgatatcttgatagtccaacaatacttgacaatgcatgttattaatgttgtatggtatgatgctattaagtttattcttctagatgagtct |
167 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33163881 |
cattgcacttgatatcttgatagtctaacaatacttgacaatgcatgttattaatgttgtatggtattatgctattaagtttattcttctagatgagtct |
33163980 |
T |
 |
| Q |
168 |
taccctttagtctttactacggttcatcaaagattaacctaagtgcgccgatatgatttat |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33163981 |
taccctttagtctttactacggttcatcaaagattaacctaagtgcgccgatatgatttat |
33164041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 33163825 - 33163872
Alignment:
| Q |
1 |
cataataagataaatagacagactaatatctataatcgtatgaacaatcatt |
52 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33163825 |
cataataagataaatagac----taatatctataatcgtatgaacaatcatt |
33163872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 68 - 147
Target Start/End: Complemental strand, 46162112 - 46162037
Alignment:
| Q |
68 |
cattgcacttgatatcttgatagtccaacaatacttgacaatgcatgttattaatgttgtatggtatgatgctattaagt |
147 |
Q |
| |
|
||||||||||||||||||||||| | |||| ||| |||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
46162112 |
cattgcacttgatatcttgatag----ataatatttgtcaatgcatgttattcatgttgtatggtatgatgatattaagt |
46162037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University