View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4689_low_41 (Length: 239)
Name: NF4689_low_41
Description: NF4689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4689_low_41 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 17 - 192
Target Start/End: Original strand, 13322470 - 13322645
Alignment:
| Q |
17 |
accctagaggatgtcaaagaaacaattctagctggatgtggttatggccctgaaagaggtgattaccatgttttaattgcatattataatttgagaataa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
13322470 |
accctagaggatgtcaaagaaacaattctagctggatgtggttatggccctgaaagaggtgattaccatgttttaattgcatattataatttgagaacaa |
13322569 |
T |
 |
| Q |
117 |
accataaagattagtatattctgtgatctaccgacttatgaagtacaaaagcagacaccgaacacgacattgacac |
192 |
Q |
| |
|
||||||||||||| ||| || |||||||||||||||||||||| | |||| ||| |||||||||||||||||||| |
|
|
| T |
13322570 |
accataaagattaatatgttttgtgatctaccgacttatgaagcatcaaagtagataccgaacacgacattgacac |
13322645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University