View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4689_low_42 (Length: 239)
Name: NF4689_low_42
Description: NF4689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4689_low_42 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 222
Target Start/End: Original strand, 46665502 - 46665706
Alignment:
| Q |
18 |
acttttctgtttccaaatagctagtgcattatattccaagatctatcgtttctcttgcatgcaacaaaacaagctcgtcatctcatgtatgttcttattg |
117 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46665502 |
acttctctgtttccaaatagctagtgcattatattccaagatcgatcgtttctcttgcatgcaacaaaacaagctcgtcatctcatgtatgttcttattg |
46665601 |
T |
|
| Q |
118 |
tgagctatttgaagaattttcttatctataattaaagaactgtgcaataatttaattctcttggtggaaaaactttgcagattgcatggtgttaaatctt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46665602 |
tgagctatttgaagaattttcttatctataattaaagaactgtgcaagaatttaattctcttggtggaaaaactttgcagattgcatggtgttaaatctt |
46665701 |
T |
|
| Q |
218 |
gattt |
222 |
Q |
| |
|
||||| |
|
|
| T |
46665702 |
gattt |
46665706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University