View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4690-Insertion-4 (Length: 224)
Name: NF4690-Insertion-4
Description: NF4690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4690-Insertion-4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 4e-71; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 8 - 170
Target Start/End: Complemental strand, 43953439 - 43953277
Alignment:
| Q |
8 |
ccttggaaccttgaaaagttcgcttcttcca-ctattatgattttgtagacaatgaactcaccaatgcttaacttaatcaaggtttcaacatgtgcaaga |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
43953439 |
ccttggaaccttgaaaagttcgcttcttccagctattatgattttgtagacaatgaactcaccaatgcttaacttaatcaaggtttcaacatgtgcatga |
43953340 |
T |
|
| Q |
107 |
gtaaccatgaatgtccggccattattatgctgctcctcggagaaattttgttgtcttatttgac |
170 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43953339 |
gtaaccatgagtgtcc-tccattattatgctgctcctcggagaaattttgttgtcttatttgac |
43953277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 170 - 224
Target Start/End: Complemental strand, 43953234 - 43953180
Alignment:
| Q |
170 |
ctaatttatttctatgccatgggatgcaacatcaatgattgtgacagcgccaaat |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43953234 |
ctaatttatttctatgccatgggatgcaacatcaatgattgtgacaccgccaaat |
43953180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University