View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4690_low_3 (Length: 377)
Name: NF4690_low_3
Description: NF4690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4690_low_3 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 153; Significance: 5e-81; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 5e-81
Query Start/End: Original strand, 91 - 251
Target Start/End: Original strand, 7557264 - 7557424
Alignment:
| Q |
91 |
taatacaatatgatagtacaatatggatctcagattaactttacattaataatttaatatagatttcaacaacgatattcatttatttcaatgttaaaat |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7557264 |
taatacaatatgatagtacaatatggatctcagattaactttacattaataatttaatatagatttcaacaacaatattcatttatttcaatgttaaaat |
7557363 |
T |
|
| Q |
191 |
atgtgggtctcgcggtgaaagatagtttattaaagcatctctagctactccataatcacca |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7557364 |
atgtgggtctcgcggtgaaagatagtttattaaagcatctctagctactccatagtcacca |
7557424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 277 - 355
Target Start/End: Original strand, 7557495 - 7557573
Alignment:
| Q |
277 |
acctctaaacatcgtcgttaacccggattattcttttatgggacaagtataaatatcttagacacactatcaaaatact |
355 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
7557495 |
acctctaaacatcgtcgttaacccggattattcttgtatgggacaagtataaatatcttagacacaataacaaaatact |
7557573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 36 - 75
Target Start/End: Original strand, 7557208 - 7557247
Alignment:
| Q |
36 |
ataaaagtaaattaccctaattcatcaagggataacgtag |
75 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
7557208 |
ataaaagtaaattactctaattcaccaagggataacgtag |
7557247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University