View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4690_low_9 (Length: 237)
Name: NF4690_low_9
Description: NF4690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4690_low_9 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 23 - 237
Target Start/End: Original strand, 36169378 - 36169596
Alignment:
| Q |
23 |
tacataatacatgatttattttcaatag----atagatagataataattagaacttccatgtgatatcatttttgaaatacccgaaccatcaacccatcc |
118 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36169378 |
tacatgatacatgatttattttcaatagatagatagatagataataattagaacttccatgtgatattatttttgaaatacccgaaccatcaacccatcc |
36169477 |
T |
 |
| Q |
119 |
ttcaaagaggcagtaagacccggcccgaatttaagctcttgattatctccatcaacccgaatctcaaaccttctaatcaaaccaacaacaacacatttca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36169478 |
ttcaaagaggcagtaagacccggcccgaatttaagctcttgattatctccatcaacccgaatctcaaaccttctaatcaaaccaacaacaacacatttca |
36169577 |
T |
 |
| Q |
219 |
tttacattaaagccaattc |
237 |
Q |
| |
|
||| ||||||||||||||| |
|
|
| T |
36169578 |
tttccattaaagccaattc |
36169596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University