View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4691-Insertion-15 (Length: 82)
Name: NF4691-Insertion-15
Description: NF4691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4691-Insertion-15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 65; Significance: 3e-29; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 65; E-Value: 3e-29
Query Start/End: Original strand, 8 - 80
Target Start/End: Original strand, 26458849 - 26458921
Alignment:
| Q |
8 |
atatcttagttgaatgaaattgagcctcgaagtggaagggatgaaattcaaggagacgcgctggttcgttcca |
80 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
26458849 |
atatcttagttgaatgaaattgagcttcgaagtggaagggatgaaattcaaggagccgcgctggttcgttcca |
26458921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University