View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4691-Insertion-18 (Length: 223)
Name: NF4691-Insertion-18
Description: NF4691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4691-Insertion-18 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 8 - 223
Target Start/End: Original strand, 28215847 - 28216061
Alignment:
| Q |
8 |
tttcgcccaataagagagtggggtattagaaagagacagttcagagcactcctctcctttatatcagtgaaagaatttgaggtaaacacagtcacgtagt |
107 |
Q |
| |
|
|||| ||||||||||||||||| | |||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
28215847 |
tttcacccaataagagagtggg-tgttagaaagagacagttcatagcactcctctcctttatatcagtgaaagaatttgaagtaaacacagtcacctagt |
28215945 |
T |
 |
| Q |
108 |
ggaagtacgcttaagtaagatgagttcaccacatatcagtatggtcttctcaattcgtagcatatcagagaatgaggtctttattgcgtgtggtcattcc |
207 |
Q |
| |
|
|||| ||| ||||| ||| || ||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28215946 |
ggaaatactcttaaataacataagttcaccacatatcagtatgatcttctcaattcgtagcatatcagagaatgatgtctttattgcgtgtggtcattcc |
28216045 |
T |
 |
| Q |
208 |
ttggcagggttactct |
223 |
Q |
| |
|
|||||||| ||||||| |
|
|
| T |
28216046 |
ttggcaggtttactct |
28216061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University