View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4691_high_17 (Length: 217)

Name: NF4691_high_17
Description: NF4691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4691_high_17
NF4691_high_17
[»] chr8 (1 HSPs)
chr8 (19-200)||(39087654-39087835)


Alignment Details
Target: chr8 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 19 - 200
Target Start/End: Original strand, 39087654 - 39087835
Alignment:
19 tgaactggacgattgattccctaccttttgtgctgcctcagattttatgctgcccgaagttgattgtggtttatctgccttctcttctgcttcactttgt 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39087654 tgaactggacgattgattccctaccttttgtgctgcctcagattttatgctgcccgaagttgattgtggtttatctgccttctcttctgcttcactttgt 39087753  T
119 ttaccatctggattagctggttgttttgacgccttctcttcggctccagaattaatactgcctaaaccactaagcagtttat 200  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39087754 ttaccatctggattagctggttgtttcgacgccttctcttcggctccagaattaatactgcctaaaccactaagcagtttat 39087835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University