View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4691_low_11 (Length: 251)
Name: NF4691_low_11
Description: NF4691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4691_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 163
Target Start/End: Complemental strand, 7076567 - 7076404
Alignment:
| Q |
1 |
ctcagctaggagaagagaagaaggagcaaggtaatgagtaagataccagattaaagagaaacaaaagacaacagaacataaacagtgtgaggaggtgtct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7076567 |
ctcagctaggagaagagaagaaggagcaaggtaatgagtaagataccagattaaagagaaacaaaagacaacagaacataaacagtgtgaggaggtgtct |
7076468 |
T |
 |
| Q |
101 |
ttgcttcttcttgtgtctgtttc-agcttttccttaatatgtgactgtttctaattgtaacagc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7076467 |
ttgcttcttcttgtgtctgtttcaagcttttccttaatatgtgactgtttctaattgtaacagc |
7076404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University