View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4691_low_14 (Length: 246)
Name: NF4691_low_14
Description: NF4691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4691_low_14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 172; Significance: 2e-92; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 50 - 233
Target Start/End: Original strand, 34277139 - 34277322
Alignment:
| Q |
50 |
cctagaaggtcctggtggactttatgagtatctacccttctttgtgagttcattgagcatgaaatttgtttgttgtaagatgttatatttgtttgttgca |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | |
|
|
| T |
34277139 |
cctagaaggtcctggtggactttatgagtatctacccttctttgtgagttcattgagcatgaaatttgtttgttgtaagatgttgtatttgtttgttgta |
34277238 |
T |
|
| Q |
150 |
agaatgatactctttttgagaaaactgatgcaactgatagtcagttcaactgacaaaaccaattctgttagtgcctttgcttct |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34277239 |
agaatgatactctttttgagaaaactgatgcaactgatagtcagttcaactgacaaaaccaattctgttagtgcctttgtttct |
34277322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 53 - 135
Target Start/End: Original strand, 29146850 - 29146932
Alignment:
| Q |
53 |
agaaggtcctggtggactttatgagtatctacccttctttgtgagttcattgagcatgaaatttgtttgttgtaagatgttat |
135 |
Q |
| |
|
||||| |||| |||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29146850 |
agaagttccttgtggacttcatgaatatctacccttctttgtgagttcattgagcatgaaatttgtttgttgtaagatgttat |
29146932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 162 - 233
Target Start/End: Original strand, 29147017 - 29147088
Alignment:
| Q |
162 |
tttttgagaaaactgatgcaactgatagtcagttcaactgacaaaaccaattctgttagtgcctttgcttct |
233 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
29147017 |
tttttgagaaaattgatgcaactgagagtcagttcaactaacaaaaccaattctgttagtgcctttgtttct |
29147088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University