View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4691_low_15 (Length: 241)
Name: NF4691_low_15
Description: NF4691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4691_low_15 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 18 - 241
Target Start/End: Original strand, 3873504 - 3873725
Alignment:
| Q |
18 |
atagaaccgtgcatttgatgtgactatcannnnnnnaagcaagttggtttggtatctttgtagaggaagtgaataagtatcctacgatgaataaaaatct |
117 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3873504 |
atagaaccgtgcatttgatgtgactatcatttttt-aagcaagttggtttggtatctttgtagaggaagtgaataagtatcctacgatgaataaaaatct |
3873602 |
T |
 |
| Q |
118 |
agtcttcaannnnnnnnnnnnaaaggagtcttcaaatgttataaataaacttttacacaagtgtacaaattatagaggatgattaatcactgaaaatcaa |
217 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| || |
|
|
| T |
3873603 |
agtcttcaattttttttttt-aaaggagtcttcaaatgttataaataaacttttacacaagtgtacaaattatagaggatgattgatcactgaaaattaa |
3873701 |
T |
 |
| Q |
218 |
taggattaacatgttcaactatat |
241 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
3873702 |
taggattaacatgttcaactatat |
3873725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University