View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4691_low_17 (Length: 225)
Name: NF4691_low_17
Description: NF4691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4691_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 15 - 209
Target Start/End: Original strand, 38304861 - 38305057
Alignment:
| Q |
15 |
cacagaatatgtcaaaattgatatctctttatccaattaagcgcattagaaaaacggatagacgaa-catgttagtgtcatgttc-gtctatttacgagc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
38304861 |
cacagaatatgtcaaaattgatatctctttatccaattaagcgcattagaaaagcggatagacgaaacatgttagtgtcatgttctgtctatttacgagc |
38304960 |
T |
 |
| Q |
113 |
acgttagtgccatgctcgtctatttgctagttaaaatataatgaatcataaaatacatccattctatttctaaattattcaacaatacagtagtatt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38304961 |
acgttagtgccatgctcgtctatttgctagttaaaatataatgaatcataaaatacatccattctatttctaaattactcaacaatacagtagtatt |
38305057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 21 - 68
Target Start/End: Complemental strand, 3261637 - 3261590
Alignment:
| Q |
21 |
atatgtcaaaattgatatctctttatccaattaagcgcattagaaaaa |
68 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||| || ||||| |
|
|
| T |
3261637 |
atatgtcaaaattgatatctctttattcaattaaacgcagtaaaaaaa |
3261590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University