View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4691_low_7 (Length: 310)
Name: NF4691_low_7
Description: NF4691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4691_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 26 - 294
Target Start/End: Original strand, 7076600 - 7076868
Alignment:
| Q |
26 |
tgctgcaattacaagatgttgtgaagtcaaggaacgctcattttttatgttttgttacagcgaaaccatacatgagatgagaaattaatgtaagatatgc |
125 |
Q |
| |
|
||||||||||||||| |||||||||||||||| || |||||||||||||||||||||| | ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7076600 |
tgctgcaattacaagctgttgtgaagtcaaggtaccctcattttttatgttttgttacggtgaaactatacatgagatgagaaattaatgtaagatatgc |
7076699 |
T |
 |
| Q |
126 |
atattgattcannnnnnncacttgtgcaggtgcaccgttccatatgcatagagcttaacggattcattgatagaattttgcatattatattagccattga |
225 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7076700 |
atattgattcatttttttcacttgtgcaggtgcaccgttccatatgcatagagcttaacggattcattgatagaattttgcatattatattagccattga |
7076799 |
T |
 |
| Q |
226 |
atcttctagaccaaattgtgccttagcaattcaagcattgtgctctttgcactttactttggataaagc |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7076800 |
atcttctagaccaaattgtgccttagcaattcaagcattgtgctctttgcactttactttggataaagc |
7076868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University