View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4692_low_4 (Length: 297)
Name: NF4692_low_4
Description: NF4692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4692_low_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 14 - 274
Target Start/End: Original strand, 1964154 - 1964418
Alignment:
| Q |
14 |
agaccttgcatatattatt----gtctttgtcaactgatataagctcatagggacatctcataggtactactaatcatactcactaaaatttcatgaagt |
109 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| ||| ||||||||||| ||||||||||||||||| |||||||||||| |||| |
|
|
| T |
1964154 |
agaccttgcatatattattaactgtctttgtcaactgatataagctcggaggaacatctcatagatactactaatcatactccctaaaatttcatcaagt |
1964253 |
T |
|
| Q |
110 |
tttattcaaaatgtgttttgtagccgcaaaacagttgtttgatattcaaccaaaaaggctccaatagaaatctaaatttctaataaagttcttattggat |
209 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1964254 |
tttattcaaaatatgttttgtagccgcaaaacagttgtttgatattcaaccaaaaaggctccaagagaaatctaaatttctaataaagttcttattggat |
1964353 |
T |
|
| Q |
210 |
tcaccttcaaagtgtttcacgcggttgcggatgacaaagtgaaaaatggattataaattaggtaa |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1964354 |
tcaccttcaaagtgtttcacgcggttgcggatgccaaagtgaaaaatggattataaattaggtaa |
1964418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University