View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4693_high_2 (Length: 317)
Name: NF4693_high_2
Description: NF4693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4693_high_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 64; Significance: 6e-28; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 1 - 80
Target Start/End: Original strand, 21602500 - 21602579
Alignment:
| Q |
1 |
gatttaaaatagatcctttagataaaaatcttatgcctctcactttctaaatcaaataattattttcggagtgcacgtcg |
80 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
21602500 |
gatttaaaatagatcatttagataaaaatcttatatctctcactttctaaatcaaataattattttcgaagtgcacgtcg |
21602579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 4 - 80
Target Start/End: Complemental strand, 1819279 - 1819203
Alignment:
| Q |
4 |
ttaaaatagatcctttagataaaaatcttatgcctctcactttctaaatcaaataattattttcggagtgcacgtcg |
80 |
Q |
| |
|
|||||| | |||| ||||||||| || | ||| || |||||||||||||||||||| ||||| ||| ||||||||| |
|
|
| T |
1819279 |
ttaaaacatatcccttagataaacatatgatgtttcacactttctaaatcaaataatcatttttggattgcacgtcg |
1819203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University