View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4693_low_2 (Length: 317)

Name: NF4693_low_2
Description: NF4693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4693_low_2
NF4693_low_2
[»] chr7 (2 HSPs)
chr7 (1-80)||(21602500-21602579)
chr7 (4-80)||(1819203-1819279)


Alignment Details
Target: chr7 (Bit Score: 64; Significance: 6e-28; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 1 - 80
Target Start/End: Original strand, 21602500 - 21602579
Alignment:
1 gatttaaaatagatcctttagataaaaatcttatgcctctcactttctaaatcaaataattattttcggagtgcacgtcg 80  Q
    ||||||||||||||| ||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||||||||    
21602500 gatttaaaatagatcatttagataaaaatcttatatctctcactttctaaatcaaataattattttcgaagtgcacgtcg 21602579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 4 - 80
Target Start/End: Complemental strand, 1819279 - 1819203
Alignment:
4 ttaaaatagatcctttagataaaaatcttatgcctctcactttctaaatcaaataattattttcggagtgcacgtcg 80  Q
    |||||| | |||| ||||||||| || | |||  || |||||||||||||||||||| ||||| ||| |||||||||    
1819279 ttaaaacatatcccttagataaacatatgatgtttcacactttctaaatcaaataatcatttttggattgcacgtcg 1819203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University