View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4694_low_10 (Length: 238)
Name: NF4694_low_10
Description: NF4694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4694_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 2 - 202
Target Start/End: Original strand, 16052118 - 16052322
Alignment:
| Q |
2 |
tgtgtttggtttgcaactaaacggtgtacttat--cgtaccctaaaagttataatgactagcgatgtatccatcttaagagattgcacatgtaaaataaa |
99 |
Q |
| |
|
|||||| || ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || |
|
|
| T |
16052118 |
tgtgttgggattgcaactaaacggtgtacttataccgtaccctaaaagttataatgactagcgatgtatccatcttaagagagtgcacatgtaaaatcaa |
16052217 |
T |
 |
| Q |
100 |
agcatgaatcacattctcaag--ttttannnnnnnnagtacaagagagggaaacacgttctcaagttagctaatgaatagagtaaaacttattccttagt |
197 |
Q |
| |
|
|||||||||||| |||||||| |||| |||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
16052218 |
agcatgaatcacgttctcaagttttttttttttttcggtacaagagagggaaacatgttctcaagttaactaatgaatagagtaaaacttattccttagt |
16052317 |
T |
 |
| Q |
198 |
ttata |
202 |
Q |
| |
|
||||| |
|
|
| T |
16052318 |
ttata |
16052322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University