View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4695_high_12 (Length: 227)
Name: NF4695_high_12
Description: NF4695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4695_high_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 52; Significance: 6e-21; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 7 - 62
Target Start/End: Original strand, 5018688 - 5018743
Alignment:
| Q |
7 |
aataggtcggggctttgcaatgtataagtctaatttgtgatgtgtcgcacgcttaa |
62 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5018688 |
aataggtcggggctttgcaatgtataagtctaatttgtgatttgtcgcacgcttaa |
5018743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 5018817 - 5018871
Alignment:
| Q |
136 |
aacttatttaaatatgtgcgatacatgtgacgtaaactttttgaaagtttatggtc |
191 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||| ||||||||| |||||||| |
|
|
| T |
5018817 |
aacttatttaaatatgtacgatccatgtgacgtaaac-ttttgaaagattatggtc |
5018871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 194 - 223
Target Start/End: Original strand, 5018860 - 5018889
Alignment:
| Q |
194 |
aagattatggtcatagcatattcaataaaa |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
5018860 |
aagattatggtcatagcatattcaataaaa |
5018889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University