View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4695_high_8 (Length: 308)
Name: NF4695_high_8
Description: NF4695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4695_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 2 - 292
Target Start/End: Complemental strand, 36568076 - 36567778
Alignment:
| Q |
2 |
gtggagaagcaaagggtggtggttttgtggagaagggtttgaatttgaagatggaaaaatatggttgaattggaagaaccttgaagaagaagagaaaaga |
101 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36568076 |
gtggtgaagaaaagggtggtggttttgtggagaagggtttgaatttgaagatggaaaaatatggttgaattggaagaaccttgaagaagaagagaaaaga |
36567977 |
T |
 |
| Q |
102 |
ttagagtaagggttatcagccatggatatattatttgatgagagatcaagtgggaacagtttatggctagctacttgagttgtttgcttttat--nnnnn |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36567976 |
ttagagtaagggttatcagccatggatatattatttgatgagagatcaagtgggaacagtttatggctagctacttgagttgtttgcttttatagagaga |
36567877 |
T |
 |
| Q |
200 |
nnnnnnnnnnntacaagatggctgaaggaagtagtggacggtg------gagagagagaagtatcatcaaacatgggaaagctaaaggtaagtggtgtg |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36567876 |
gagagagagagtacaagatggctgaaggaagtagtggacggtggagagagagagagagaagtatcatcaaacatgggaaagctaaaggtaagtggtgtg |
36567778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University